Skip to main content

Advertisement

Table 1 Primers

From: A study on genetic polymorphism in Matrix Metalloproteinases-3 in oral submucous fibrosis patients and in healthy individuals

Primer Name Sequence (5′–3′) GC Content (%) Tm (°C) Product Size
MMP F GGTTCTCCATTCCTTTGATGGGGGGAAAGA 50 77.7 129
MMP R CTTCCTGGAATTCACATCACTGCCACCACT 50 76.6