Skip to main content

Table 1 Primers

From: A study on genetic polymorphism in Matrix Metalloproteinases-3 in oral submucous fibrosis patients and in healthy individuals

Primer Name Sequence
(5′–3′)
GC Content
(%)
Tm
(°C)
Product Size
MMP F GGTTCTCCATTCCTTTGATGGGGGGAAAGA 50 77.7 129
MMP R CTTCCTGGAATTCACATCACTGCCACCACT 50 76.6
\